View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12132_low_3 (Length: 236)
Name: NF12132_low_3
Description: NF12132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12132_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 22 - 183
Target Start/End: Complemental strand, 40998943 - 40998782
Alignment:
| Q |
22 |
aggcttttggttgattgaaattgtgggattattatggcattgaatatttctatgtgcagtggtcaatttcatcttaattatcttaaggatagcttagtta |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40998943 |
aggcttttggttgattgaaattgtgggattattatggcattgaatatttgtatgtgcagtggtcaatttcatcttaattatcttaaggatagcttagtta |
40998844 |
T |
 |
| Q |
122 |
agattaagttagccaatcataaaacacaattgtggaatatcgagtcaaaaagaatcttggct |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40998843 |
agattaagttagccaatcataaaacacaattgtggaatatcgagtcaaaaagaatcttggct |
40998782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 177 - 218
Target Start/End: Complemental strand, 40998770 - 40998729
Alignment:
| Q |
177 |
cttggctcacaactcaaaactacaaacacatcttggctgcat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40998770 |
cttggctcacaactcaaaactacaaacacatcttggctgcat |
40998729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University