View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12136_high_3 (Length: 370)

Name: NF12136_high_3
Description: NF12136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12136_high_3
NF12136_high_3
[»] chr2 (7 HSPs)
chr2 (150-370)||(3921695-3921916)
chr2 (332-370)||(1551556-1551594)
chr2 (329-370)||(1895536-1895577)
chr2 (329-370)||(17281899-17281940)
chr2 (153-196)||(3352650-3352693)
chr2 (332-370)||(17375403-17375441)
chr2 (163-196)||(40104521-40104554)
[»] chr6 (2 HSPs)
chr6 (329-370)||(20740704-20740745)
chr6 (156-204)||(29377242-29377290)
[»] chr8 (3 HSPs)
chr8 (329-370)||(10408951-10408992)
chr8 (329-368)||(5994757-5994797)
chr8 (163-196)||(35700322-35700355)
[»] chr7 (3 HSPs)
chr7 (329-370)||(3302701-3302742)
chr7 (166-196)||(24483824-24483854)
chr7 (154-194)||(31294006-31294046)
[»] chr5 (6 HSPs)
chr5 (329-370)||(7271900-7271941)
chr5 (329-370)||(7766960-7767001)
chr5 (329-369)||(41355501-41355541)
chr5 (153-196)||(17193511-17193554)
chr5 (329-364)||(27170044-27170079)
chr5 (329-370)||(6030342-6030383)
[»] chr4 (4 HSPs)
chr4 (329-370)||(23054189-23054230)
chr4 (329-370)||(53202392-53202433)
chr4 (335-370)||(47518412-47518447)
chr4 (156-196)||(10147617-10147657)
[»] scaffold0003 (1 HSPs)
scaffold0003 (155-194)||(418435-418474)
[»] chr1 (4 HSPs)
chr1 (332-370)||(34655081-34655119)
chr1 (329-370)||(39708976-39709017)
chr1 (329-370)||(615831-615872)
chr1 (163-196)||(32864398-32864431)


Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 7)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 150 - 370
Target Start/End: Complemental strand, 3921916 - 3921695
Alignment:
150 ggatcaaaagttcgaaccccc-tgatccagggtcctggcaacgccactacggacagttacttggattgtcaatggctacaatgacgctacaacggctgaa 248  Q
    |||||||||||| |||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||    
3921916 ggatcaaaagtttgaacccccctgatccagggtcctggcaacgccactacgggcagttacttggattgtcaatggctacaataacgctacaacggctgaa 3921817  T
249 gcttgtgctatgttttttaactgtaaatttgacgcatggttattgctttcgttcgatcaatttgagatagattgttaacactcttggttgtggtggatgt 348  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3921816 gcttgtgctatgttttttaactgtaaatttcacgcatggttattgctttcgttcgatcaatttgagatagattgttaacactcttggttgtggtggatgt 3921717  T
349 tatgtttgctcgcaacataggt 370  Q
    ||||||||||||||||||||||    
3921716 tatgtttgctcgcaacataggt 3921695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 332 - 370
Target Start/End: Original strand, 1551556 - 1551594
Alignment:
332 ttggttgtggtggatgttatgtttgctcgcaacataggt 370  Q
    |||||||||||||||||||||||||||||||||||||||    
1551556 ttggttgtggtggatgttatgtttgctcgcaacataggt 1551594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 329 - 370
Target Start/End: Complemental strand, 1895577 - 1895536
Alignment:
329 ctcttggttgtggtggatgttatgtttgctcgcaacataggt 370  Q
    ||||||||||||||||| ||||||| ||||||||||||||||    
1895577 ctcttggttgtggtggaggttatgtctgctcgcaacataggt 1895536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 329 - 370
Target Start/End: Original strand, 17281899 - 17281940
Alignment:
329 ctcttggttgtggtggatgttatgtttgctcgcaacataggt 370  Q
    |||||||| |||||||| ||||||||||||||||||||||||    
17281899 ctcttggtagtggtggaggttatgtttgctcgcaacataggt 17281940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 153 - 196
Target Start/End: Original strand, 3352650 - 3352693
Alignment:
153 tcaaaagttcgaaccccctgatccagggtcctggcaacgccact 196  Q
    ||||||||||||||||||| | | ||||||||||||||||||||    
3352650 tcaaaagttcgaaccccctaacctagggtcctggcaacgccact 3352693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 332 - 370
Target Start/End: Complemental strand, 17375441 - 17375403
Alignment:
332 ttggttgtggtggatgttatgtttgctcgcaacataggt 370  Q
    |||||||||||||| ||||||||||||| ||||||||||    
17375441 ttggttgtggtggaggttatgtttgctcacaacataggt 17375403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 196
Target Start/End: Original strand, 40104521 - 40104554
Alignment:
163 gaaccccctgatccagggtcctggcaacgccact 196  Q
    ||||||||||| ||||||||||||||||||||||    
40104521 gaaccccctgagccagggtcctggcaacgccact 40104554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 329 - 370
Target Start/End: Complemental strand, 20740745 - 20740704
Alignment:
329 ctcttggttgtggtggatgttatgtttgctcgcaacataggt 370  Q
    ||||||||||||||||||||||||||||||||||||||||||    
20740745 ctcttggttgtggtggatgttatgtttgctcgcaacataggt 20740704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 156 - 204
Target Start/End: Complemental strand, 29377290 - 29377242
Alignment:
156 aaagttcgaaccccctgatccagggtcctggcaacgccactacggacag 204  Q
    |||||| ||||||||| | | |||||||||||||||||||| |||||||    
29377290 aaagtttgaaccccctaacctagggtcctggcaacgccactgcggacag 29377242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 329 - 370
Target Start/End: Complemental strand, 10408992 - 10408951
Alignment:
329 ctcttggttgtggtggatgttatgtttgctcgcaacataggt 370  Q
    ||||||||||||||||| ||||||||||||||||||||||||    
10408992 ctcttggttgtggtggaggttatgtttgctcgcaacataggt 10408951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 368
Target Start/End: Complemental strand, 5994797 - 5994757
Alignment:
329 ctcttggttgtgg-tggatgttatgtttgctcgcaacatag 368  Q
    ||||||||||||| |||||||||||||||||||||||||||    
5994797 ctcttggttgtggatggatgttatgtttgctcgcaacatag 5994757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 196
Target Start/End: Complemental strand, 35700355 - 35700322
Alignment:
163 gaaccccctgatccagggtcctggcaacgccact 196  Q
    |||||||||| |||||||||||||||||||||||    
35700355 gaaccccctggtccagggtcctggcaacgccact 35700322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 329 - 370
Target Start/End: Complemental strand, 3302742 - 3302701
Alignment:
329 ctcttggttgtggtggatgttatgtttgctcgcaacataggt 370  Q
    ||||||||||||||||| ||||||||||||||||||||||||    
3302742 ctcttggttgtggtggaggttatgtttgctcgcaacataggt 3302701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 166 - 196
Target Start/End: Complemental strand, 24483854 - 24483824
Alignment:
166 ccccctgatccagggtcctggcaacgccact 196  Q
    |||||||||||||||||||||||||||||||    
24483854 ccccctgatccagggtcctggcaacgccact 24483824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 154 - 194
Target Start/End: Original strand, 31294006 - 31294046
Alignment:
154 caaaagttcgaaccccctgatccagggtcctggcaacgcca 194  Q
    |||| ||| ||||||||||| ||||||||||||||||||||    
31294006 caaaggtttgaaccccctgacccagggtcctggcaacgcca 31294046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 6)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 329 - 370
Target Start/End: Complemental strand, 7271941 - 7271900
Alignment:
329 ctcttggttgtggtggatgttatgtttgctcgcaacataggt 370  Q
    ||||||||||||||||| ||||||||||||||||||||||||    
7271941 ctcttggttgtggtggaggttatgtttgctcgcaacataggt 7271900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 329 - 370
Target Start/End: Original strand, 7766960 - 7767001
Alignment:
329 ctcttggttgtggtggatgttatgtttgctcgcaacataggt 370  Q
    |||||||||||| |||| ||||||||||||||||||||||||    
7766960 ctcttggttgtgatggaggttatgtttgctcgcaacataggt 7767001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 369
Target Start/End: Original strand, 41355501 - 41355541
Alignment:
329 ctcttggttgtggtggatgttatgtttgctcgcaacatagg 369  Q
    ||||||||||||||||| ||||| |||||||||||||||||    
41355501 ctcttggttgtggtggaggttatatttgctcgcaacatagg 41355541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 153 - 196
Target Start/End: Complemental strand, 17193554 - 17193511
Alignment:
153 tcaaaagttcgaaccccctgatccagggtcctggcaacgccact 196  Q
    ||||||||| ||||||||||||| |||||||| |||||||||||    
17193554 tcaaaagtttgaaccccctgatctagggtcctagcaacgccact 17193511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 329 - 364
Target Start/End: Original strand, 27170044 - 27170079
Alignment:
329 ctcttggttgtggtggatgttatgtttgctcgcaac 364  Q
    ||||||||||||||||| ||||||||||||||||||    
27170044 ctcttggttgtggtggaggttatgtttgctcgcaac 27170079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 370
Target Start/End: Original strand, 6030342 - 6030383
Alignment:
329 ctcttggttgtggtggatgttatgtttgctcgcaacataggt 370  Q
    |||||||||| ||||||||||||||||| ||| |||||||||    
6030342 ctcttggttgcggtggatgttatgtttgatcggaacataggt 6030383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 329 - 370
Target Start/End: Original strand, 23054189 - 23054230
Alignment:
329 ctcttggttgtggtggatgttatgtttgctcgcaacataggt 370  Q
    ||||||||||||||||| ||||||||||||||||||||||||    
23054189 ctcttggttgtggtggaggttatgtttgctcgcaacataggt 23054230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 329 - 370
Target Start/End: Complemental strand, 53202433 - 53202392
Alignment:
329 ctcttggttgtggtggatgttatgtttgctcgcaacataggt 370  Q
    ||||||||||||||||| ||||||||||||||||||||||||    
53202433 ctcttggttgtggtggaggttatgtttgctcgcaacataggt 53202392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 335 - 370
Target Start/End: Original strand, 47518412 - 47518447
Alignment:
335 gttgtggtggatgttatgtttgctcgcaacataggt 370  Q
    ||||||||||| ||||||||||||||||||||||||    
47518412 gttgtggtggaggttatgtttgctcgcaacataggt 47518447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 156 - 196
Target Start/End: Complemental strand, 10147657 - 10147617
Alignment:
156 aaagttcgaaccccctgatccagggtcctggcaacgccact 196  Q
    |||||| ||||||||| | ||||||||||||||||||||||    
10147657 aaagtttgaaccccctaacccagggtcctggcaacgccact 10147617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 155 - 194
Target Start/End: Original strand, 418435 - 418474
Alignment:
155 aaaagttcgaaccccctgatccagggtcctggcaacgcca 194  Q
    ||||||| ||||||||||||||||||||||||||||||||    
418435 aaaagtttgaaccccctgatccagggtcctggcaacgcca 418474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 332 - 370
Target Start/End: Complemental strand, 34655119 - 34655081
Alignment:
332 ttggttgtggtggatgttatgtttgctcgcaacataggt 370  Q
    |||||||||||||| ||||||||||||||||||||||||    
34655119 ttggttgtggtggaggttatgtttgctcgcaacataggt 34655081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 329 - 370
Target Start/End: Original strand, 39708976 - 39709017
Alignment:
329 ctcttggttgtggtggatgttatgtttgctcgcaacataggt 370  Q
    ||||||||||||||||| ||||||||||||||||| ||||||    
39708976 ctcttggttgtggtggaggttatgtttgctcgcaatataggt 39709017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 370
Target Start/End: Complemental strand, 615872 - 615831
Alignment:
329 ctcttggttgtggtggatgttatgtttgctcgcaacataggt 370  Q
    |||||||||||||||||  ||||||||| |||||||||||||    
615872 ctcttggttgtggtggagattatgtttgatcgcaacataggt 615831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 196
Target Start/End: Original strand, 32864398 - 32864431
Alignment:
163 gaaccccctgatccagggtcctggcaacgccact 196  Q
    |||||||||| |||||||||||||||||||||||    
32864398 gaaccccctggtccagggtcctggcaacgccact 32864431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University