View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12136_high_7 (Length: 228)
Name: NF12136_high_7
Description: NF12136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12136_high_7 |
 |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 15 - 210
Target Start/End: Complemental strand, 32782200 - 32782000
Alignment:
| Q |
15 |
ctgtggtaaaagagtgattttgaatttgttgagtttgtttgtgttcaagttttagggtgatatgtgctatactgtgattaaattttttgtatattcattg |
114 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32782200 |
ctgtagtaaaagactgattttgaatttgttgagtttgtttgtgttcaagttttagggtgatatgtgctatactgtgattaatttttttgtatattcattg |
32782101 |
T |
 |
| Q |
115 |
aaatgag-----nnnnnnngtggctttagcaattcaggtcttcaggagagaagtcagtaaaagaagaagcattggagactttgaaagctatggggactgc |
209 |
Q |
| |
|
||||| | |||| ||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32782100 |
aaatgtgtttttttttttggtggttttagcaattcaggtcttctggagagaagtcagtaaaggaagaagcattggagactttgaaagctatggggactgc |
32782001 |
T |
 |
| Q |
210 |
t |
210 |
Q |
| |
|
| |
|
|
| T |
32782000 |
t |
32782000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 94748 - 94805
Alignment:
| Q |
153 |
aggagagaagtcagtaaaagaagaagcattggagactttgaaagctatggggactgct |
210 |
Q |
| |
|
||||||||| |||||||| ||||||||| |||||| |||||||||||| || ||||| |
|
|
| T |
94748 |
aggagagaaatcagtaaaggaagaagcaccggagaccttgaaagctatgcggtctgct |
94805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University