View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12136_high_9 (Length: 226)
Name: NF12136_high_9
Description: NF12136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12136_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 40463692 - 40463590
Alignment:
| Q |
1 |
taagcatatgaatgaacaagggtttctcataatcagcgatatcaagaattttgcattgacagtggacctacgacggaacatcgtaaatcttgtatgtgtt |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40463692 |
taagcatatgaaagaacaagggtttctcataatcagcgatatcaagaattttgcattgacagtggacctacgacggaacatcgtaaatcttgtatgtgtt |
40463593 |
T |
 |
| Q |
101 |
ata |
103 |
Q |
| |
|
||| |
|
|
| T |
40463592 |
ata |
40463590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 168 - 226
Target Start/End: Complemental strand, 40463525 - 40463467
Alignment:
| Q |
168 |
gaaatatgcttgtatatgcctattcgctgctgatttagtgtgagtattatatatggtta |
226 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40463525 |
gaaatatgcttgcatatgcctattcgctgctgatttagtgtgagtgttatatatggtta |
40463467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University