View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12136_low_10 (Length: 217)
Name: NF12136_low_10
Description: NF12136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12136_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 17 - 207
Target Start/End: Complemental strand, 2928357 - 2928167
Alignment:
| Q |
17 |
agatacttcagaaactaaataaatattttaagaatttatgagcaatgactctgtttatgctacttattcttccttatagataggttcatgatcagtagcc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2928357 |
agatacttcagaaactaaataaatattttaagaatttatgagcaatgactctgtttatgctacttattcttccttatagataggttcatgatcagtggcc |
2928258 |
T |
|
| Q |
117 |
ttaagttttctattgatgcatctatatcacctttgtaacattctattacgactatctaacaatgatctggtatggcttttttctgtgctgc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2928257 |
ttaagttttctattgatgcatctatatcacctttgtaacattctattacgactatctaacagtgatctggtatggcttttttctgtgctgc |
2928167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 37 - 95
Target Start/End: Original strand, 2310927 - 2310985
Alignment:
| Q |
37 |
aaatattttaagaatttatgagcaatgactctgtttatgctacttattcttccttatag |
95 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| || |||||||||||||||| |
|
|
| T |
2310927 |
aaatattttaagaatttatgagcaatggctctgtttatgttaattattcttccttatag |
2310985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University