View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12136_low_9 (Length: 226)

Name: NF12136_low_9
Description: NF12136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12136_low_9
NF12136_low_9
[»] chr7 (2 HSPs)
chr7 (1-103)||(40463590-40463692)
chr7 (168-226)||(40463467-40463525)


Alignment Details
Target: chr7 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 40463692 - 40463590
Alignment:
1 taagcatatgaatgaacaagggtttctcataatcagcgatatcaagaattttgcattgacagtggacctacgacggaacatcgtaaatcttgtatgtgtt 100  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40463692 taagcatatgaaagaacaagggtttctcataatcagcgatatcaagaattttgcattgacagtggacctacgacggaacatcgtaaatcttgtatgtgtt 40463593  T
101 ata 103  Q
    |||    
40463592 ata 40463590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 168 - 226
Target Start/End: Complemental strand, 40463525 - 40463467
Alignment:
168 gaaatatgcttgtatatgcctattcgctgctgatttagtgtgagtattatatatggtta 226  Q
    |||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||    
40463525 gaaatatgcttgcatatgcctattcgctgctgatttagtgtgagtgttatatatggtta 40463467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University