View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12137_low_2 (Length: 417)
Name: NF12137_low_2
Description: NF12137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12137_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 6e-50; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 18 - 139
Target Start/End: Complemental strand, 50529894 - 50529767
Alignment:
| Q |
18 |
ggttgctgtcgttgttgttttactcatcacagtggttatctgctacaggtttgtaactgatccttcttgatcaacat------ccaccattaagcacagt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
50529894 |
ggttgctgtcgttgttgttttactcatcacagtggttatctgctacaggtttgtaactgatccttcttgatcaacatccacatccaccactaagcacagt |
50529795 |
T |
|
| Q |
112 |
cacagacaacaaacacgatatgatacac |
139 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
50529794 |
cacagacaacaaacacgatatgatacac |
50529767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 339 - 402
Target Start/End: Complemental strand, 50529559 - 50529496
Alignment:
| Q |
339 |
cagtacgagggaaagttcggtggtgaatatgatattgacggggttgcacatactgttcatagca |
402 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50529559 |
cagtacgaaggaaagttcggtggtgaatatgatattgacggggttgcacatactgttcatagca |
50529496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 227 - 294
Target Start/End: Complemental strand, 50529684 - 50529617
Alignment:
| Q |
227 |
ctcagacatcggacacaccttgatcagaggtgccggtgccatgagttcatcatttacaatggagctca |
294 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
50529684 |
ctcagacatcggacacactttgatcagaggtgccggtgctatgagttcatcatttacaatggagctca |
50529617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University