View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12139_high_4 (Length: 268)
Name: NF12139_high_4
Description: NF12139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12139_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 153 - 253
Target Start/End: Original strand, 5058835 - 5058935
Alignment:
| Q |
153 |
gtcattttaacaaatgtcataagggaactttttagcaatttccataatactaaggatcatatcaacttatgtccttaaggcagacgagggaacaagttag |
252 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5058835 |
gtcattttaacaaatgttataagggaactttttagcaatttccataataccaaggatcatatcaacttatgtccttaaggcagacgagggaacaagttag |
5058934 |
T |
 |
| Q |
253 |
t |
253 |
Q |
| |
|
| |
|
|
| T |
5058935 |
t |
5058935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 14 - 83
Target Start/End: Original strand, 5058696 - 5058765
Alignment:
| Q |
14 |
agatgcacaaacaccacagatattcgcatgaataatactagggttgtgctaagtttgcaatgagttcaac |
83 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5058696 |
agatgcacaaacaccacaaatattcgcatgaataaaactagggttgtgctaagtttgcaatgagttcaac |
5058765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University