View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12139_high_5 (Length: 265)

Name: NF12139_high_5
Description: NF12139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12139_high_5
NF12139_high_5
[»] chr4 (2 HSPs)
chr4 (19-114)||(53174103-53174193)
chr4 (217-247)||(53173965-53173995)


Alignment Details
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 19 - 114
Target Start/End: Complemental strand, 53174193 - 53174103
Alignment:
19 atttctggtaggaaacctgtggatgtgtctcaccaaagtttacatagctgggtaagtaagtagagtagagtagagtagactagccccacttttgat 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||    
53174193 atttctggtaggaaacctgtggatgtgtctcaccaaagtttacatagctgggtaagtaagtagagtagag-----tagactagccccacttttgat 53174103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 217 - 247
Target Start/End: Complemental strand, 53173995 - 53173965
Alignment:
217 ggtcatctgggttgtctatatagtcacattt 247  Q
    |||||||||||||||||||||||||||||||    
53173995 ggtcatctgggttgtctatatagtcacattt 53173965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University