View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12139_high_6 (Length: 224)
Name: NF12139_high_6
Description: NF12139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12139_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 2e-60; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 37 - 162
Target Start/End: Original strand, 17493942 - 17494066
Alignment:
| Q |
37 |
ccgcctttacacaaaaaacaaccgtagtactaccgactaataactgttgtggatgtgttctcaatggaatttattatttttggtatacaattgtgttgat |
136 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17493942 |
ccgcctttacacaaaa-acaaccgtagtactaccgactaataactgttgtggatgtgttctcaatggaatttattatttttggtatacaattgtgttgat |
17494040 |
T |
 |
| Q |
137 |
aatgatttaagtcagtggtttcttat |
162 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
17494041 |
aatgatttaagtcagtggtttcttat |
17494066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 37 - 162
Target Start/End: Complemental strand, 17559272 - 17559148
Alignment:
| Q |
37 |
ccgcctttacacaaaaaacaaccgtagtactaccgactaataactgttgtggatgtgttctcaatggaatttattatttttggtatacaattgtgttgat |
136 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17559272 |
ccgcctttacacaaaaa-caaccgtagtactaccgactaataactgttgtggatgtgttctcaatggaatttattatttttggtatacaattgtgttgat |
17559174 |
T |
 |
| Q |
137 |
aatgatttaagtcagtggtttcttat |
162 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
17559173 |
aatgatttaagtcagtggtttcttat |
17559148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 212
Target Start/End: Original strand, 17494088 - 17494126
Alignment:
| Q |
174 |
tcagtggctttttaggtttccttataaaatgcacaggtt |
212 |
Q |
| |
|
||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17494088 |
tcaatggctttttaggtttccttataaaatgtacaggtt |
17494126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 178 - 212
Target Start/End: Complemental strand, 17559122 - 17559088
Alignment:
| Q |
178 |
tggctttttaggtttccttataaaatgcacaggtt |
212 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17559122 |
tggctttttaggtttccttataaaatgtacaggtt |
17559088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University