View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12139_high_7 (Length: 219)
Name: NF12139_high_7
Description: NF12139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12139_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 11677492 - 11677309
Alignment:
| Q |
1 |
atgagaactagacgttcacataggaaatgtggttgaaatagagataaacaagagacaatggaggtgcaaattgtactgtgcaaagatatttagtatgcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11677492 |
atgagaactagacgttcacataggaaatgtggttgaaatagagataaacaagagacaatggaggtgcaaattgtactgtgcaaagatatttagtgtgcaa |
11677393 |
T |
|
| Q |
101 |
actcagcagcaacatacatcagcacatacatacatcaacacatacatggttgactgattcaacaacaaactttctctaatgcttctaccatcgacgggag |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
11677392 |
actcagcagcaacatacatcagcacat----------------acatggttgactgattcaacaacaaactttctctaatgcttctgccattgacgggag |
11677309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 6 - 80
Target Start/End: Original strand, 19473380 - 19473454
Alignment:
| Q |
6 |
aactagacgttcacataggaaatgtggttgaaatagagataaacaagagacaatggaggtgcaaattgtactgtg |
80 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||| ||||||||||||| | ||||| ||||||||||| |||| |
|
|
| T |
19473380 |
aactagacgttcacataggaaaggttgttgaaatagcgataaacaagagatagtggagatgcaaattgtattgtg |
19473454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 11 - 84
Target Start/End: Original strand, 42251476 - 42251549
Alignment:
| Q |
11 |
gacgttcacataggaaatgtggttgaaatagagataaacaagagacaatggaggtgcaaattgtactgtgcaaa |
84 |
Q |
| |
|
||||||||||||| ||| ||||| ||| ||| |||||| ||||||| | ||||||||| ||||||||||||||| |
|
|
| T |
42251476 |
gacgttcacatagaaaaagtggtagaagtagcgataaataagagacgacggaggtgcagattgtactgtgcaaa |
42251549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University