View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12139_low_4 (Length: 274)
Name: NF12139_low_4
Description: NF12139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12139_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 16 - 268
Target Start/End: Complemental strand, 9137986 - 9137734
Alignment:
| Q |
16 |
cagtaactgccgagtaaaactctgtgagagcttaatcatatttatggcaattaagttcttgcttttactcttaatgtatcaatgaagttattctgaactg |
115 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9137986 |
cagtaactgccgagtaaaactccgtgagagcttgatcatatttatggcaattaagttcttgcttttactcttaatgtatcaatgaagttattctgaactg |
9137887 |
T |
|
| Q |
116 |
gatgctaatgtcattgtacaaaacttattttgtagcttgctaacatcatgggtcgttctcagtggctgacatgtccaagaaaggtagctctcttacacat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9137886 |
gatgctaatgtcattgtacaaaacttattttgtagcttgctaacatcatgggtcgttctcagtggctgacatgtccaagaaaggtagctctctaacacat |
9137787 |
T |
|
| Q |
216 |
cacatattaataggtcttttattcaacaaccagctaacttgtgttcatctcac |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9137786 |
cacatattaataggtcttttattcaacaaccagctaacttgtgttcatttcac |
9137734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University