View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12139_low_6 (Length: 265)
Name: NF12139_low_6
Description: NF12139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12139_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 19 - 114
Target Start/End: Complemental strand, 53174193 - 53174103
Alignment:
| Q |
19 |
atttctggtaggaaacctgtggatgtgtctcaccaaagtttacatagctgggtaagtaagtagagtagagtagagtagactagccccacttttgat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
53174193 |
atttctggtaggaaacctgtggatgtgtctcaccaaagtttacatagctgggtaagtaagtagagtagag-----tagactagccccacttttgat |
53174103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 217 - 247
Target Start/End: Complemental strand, 53173995 - 53173965
Alignment:
| Q |
217 |
ggtcatctgggttgtctatatagtcacattt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
53173995 |
ggtcatctgggttgtctatatagtcacattt |
53173965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University