View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1213_high_100 (Length: 219)

Name: NF1213_high_100
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1213_high_100
NF1213_high_100
[»] chr5 (1 HSPs)
chr5 (1-116)||(25860910-25861025)


Alignment Details
Target: chr5 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 25860910 - 25861025
Alignment:
1 tagcaaagttgactggactaaaatatattttgaaaactatgaattagttgagaatggcttaagaacaaactactttggaaccaaagaattaactagaatt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||||||||||||||||||||||||    
25860910 tagcaaagttgactggactaaaatatattttgaaaactatgaattagttgagaaaggcctaagaacaaactattttggaaccaaagaattaactagaatt 25861009  T
101 ctgattccccttcttc 116  Q
    ||||||||||||||||    
25861010 ctgattccccttcttc 25861025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University