View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_high_33 (Length: 418)
Name: NF1213_high_33
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_high_33 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold0386 (2 HSPs) |
 |  |  |
|
| [»] scaffold0282 (1 HSPs) |
 |  |  |
|
| [»] scaffold0188 (1 HSPs) |
 |  |  |
|
| [»] scaffold0171 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 303; Significance: 1e-170; HSPs: 12)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 1 - 410
Target Start/End: Complemental strand, 28252645 - 28252220
Alignment:
| Q |
1 |
agtaattttgttcaatctaacagtctttagaggtattgggttgttaggttgtgagaactcacctaagag-----ggggttgtgatgacggagcatcatat |
95 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||||||| |
|
|
| T |
28252645 |
agtaattttgttcaatctaacagactttagaggtattgggttgttaggttgtgagaactcacctaacagattagggggttgtgatgaaggagcatcatat |
28252546 |
T |
 |
| Q |
96 |
gatattttttgctatgtttttagtacttttattcgcatttaa----------gatgagagttagaagagatgtcaatgcagaatatttcatgataacttc |
185 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28252545 |
gatattttttgttatgtttttaatacttttattcgtatttaaagacaaataagatgagagttagaagagatgtcaatgcagaatattccatgataacttc |
28252446 |
T |
 |
| Q |
186 |
aaattacttgcattgttgagactaattaaagatctcatgttgagacaaccttgatcaacaagtctacatatcttcttcaaagaaattatagctatttttc |
285 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28252445 |
aaattacttgcattgttgagcctaattagagatctgatgttgagacaacctttatcaacaagtctacatatcttcttcaaagaaattatagcaatttttc |
28252346 |
T |
 |
| Q |
286 |
atagcatatatgttgaataaatccttaagagaattcaaacctgagctttcttctttgtagtatatcatcaaatcatcaacataaaaagagagaga-atgt |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
28252345 |
atagcatatatgttgaataaatccttaagagaattcaaacctgagctttcttctttgtagtatataatcaaatcatcaacataaaaagagagagagatgt |
28252246 |
T |
 |
| Q |
385 |
attgagatgttccttgtccctatgat |
410 |
Q |
| |
|
||| ||||||||||||||||| |||| |
|
|
| T |
28252245 |
attcagatgttccttgtccctttgat |
28252220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 71 - 135
Target Start/End: Complemental strand, 16052466 - 16052402
Alignment:
| Q |
71 |
gggttgtgatgacggagcatcatatgatattttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
16052466 |
gggttgtgatgacggagcatcatatgatatttttggctatgtttttagtacttttatttgcattt |
16052402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 69 - 135
Target Start/End: Original strand, 24120155 - 24120221
Alignment:
| Q |
69 |
gggggttgtgatgacggagcatcatatgatattttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
24120155 |
gggggttgtgatgacgaatcatcatatgatattttttgctatgtttttagtacttttctttgcattt |
24120221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 74 - 135
Target Start/End: Complemental strand, 22894720 - 22894659
Alignment:
| Q |
74 |
ttgtgatgacggagcatcatatgatattttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
|||||||||| ||||||||||||| |||||| | |||||||||||||||||| ||||||||| |
|
|
| T |
22894720 |
ttgtgatgacagagcatcatatgacatttttaggtatgtttttagtacttttcttcgcattt |
22894659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 85 - 123
Target Start/End: Complemental strand, 11310379 - 11310341
Alignment:
| Q |
85 |
gagcatcatatgatattttttgctatgtttttagtactt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11310379 |
gagcatcatatgatattttttgctatgtttttagtactt |
11310341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 70 - 119
Target Start/End: Original strand, 10866913 - 10866962
Alignment:
| Q |
70 |
ggggttgtgatgacggagcatcatatgatattttttgctatgtttttagt |
119 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||| |||| ||||||| |
|
|
| T |
10866913 |
ggggttgtgatgatggaacatcatatgatattttttggtatgattttagt |
10866962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 76 - 135
Target Start/End: Original strand, 6358629 - 6358688
Alignment:
| Q |
76 |
gtgatgacggagcatcatatgatattttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
|||||||| ||||| |||||| ||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
6358629 |
gtgatgacagagcactatatgacattttgggctatgtttttagtacttttatttgcattt |
6358688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 70 - 103
Target Start/End: Complemental strand, 5570338 - 5570305
Alignment:
| Q |
70 |
ggggttgtgatgacggagcatcatatgatatttt |
103 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
5570338 |
ggggttgtgataacggagcatcatatgatatttt |
5570305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 87 - 135
Target Start/End: Original strand, 12956431 - 12956479
Alignment:
| Q |
87 |
gcatcatatgatattttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||| || |||||| |
|
|
| T |
12956431 |
gcatcatgtgatatttttgtctatgtttttagtacttttctttgcattt |
12956479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 87 - 135
Target Start/End: Complemental strand, 14977280 - 14977232
Alignment:
| Q |
87 |
gcatcatatgatattttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||| || |||||| |
|
|
| T |
14977280 |
gcatcatatgatatttttaactatgtttttagcacttttctttgcattt |
14977232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 75 - 119
Target Start/End: Complemental strand, 30851284 - 30851240
Alignment:
| Q |
75 |
tgtgatgacggagcatcatatgatattttttgctatgtttttagt |
119 |
Q |
| |
|
|||||||| ||| | ||||||||||||||| |||||||||||||| |
|
|
| T |
30851284 |
tgtgatgatggaacgtcatatgatatttttggctatgtttttagt |
30851240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 77 - 125
Target Start/End: Original strand, 32239219 - 32239267
Alignment:
| Q |
77 |
tgatgacggagcatcatatgatattttttgctatgtttttagtactttt |
125 |
Q |
| |
|
|||||| || ||||| |||||||||||| ||||||||||||| |||||| |
|
|
| T |
32239219 |
tgatgatggtgcatcgtatgatatttttggctatgtttttagcactttt |
32239267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 4e-17; HSPs: 8)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 70 - 135
Target Start/End: Original strand, 24841678 - 24841743
Alignment:
| Q |
70 |
ggggttgtgatgacggagcatcatatgatattttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||||||| || || |||||| |
|
|
| T |
24841678 |
ggggttgtgatgacagagcatcatatgacattttttgctatgtttttagtactattctttgcattt |
24841743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 70 - 137
Target Start/End: Complemental strand, 11274520 - 11274454
Alignment:
| Q |
70 |
ggggttgtgatgacggagcatcatatgatattttttgctatgtttttagtacttttattcgcatttaa |
137 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||| |||||||||||||| || |||||||| |
|
|
| T |
11274520 |
ggggttgtgatgaaggagcatcatttgatattttttgctat-tttttagtacttttctttgcatttaa |
11274454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 70 - 137
Target Start/End: Original strand, 17027452 - 17027519
Alignment:
| Q |
70 |
ggggttgtgatgacggagcatcatatgatattttttgctatgtttttagtacttttattcgcatttaa |
137 |
Q |
| |
|
|||||||||| || |||||||||||||| |||||| |||||||||||||||||||| || |||||||| |
|
|
| T |
17027452 |
ggggttgtgacgagggagcatcatatgacatttttggctatgtttttagtacttttctttgcatttaa |
17027519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 85 - 135
Target Start/End: Complemental strand, 17382210 - 17382160
Alignment:
| Q |
85 |
gagcatcatatgatattttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| || |||||| |
|
|
| T |
17382210 |
gagcatcatatgatattttttgctatgtgtttagtacttttttttgcattt |
17382160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 77 - 135
Target Start/End: Complemental strand, 25594875 - 25594817
Alignment:
| Q |
77 |
tgatgacggagcatcatatgatattttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
||||||| ||||||||||| ||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
25594875 |
tgatgacagagcatcatatattatttttggctatgtttttagtacttttatttgcattt |
25594817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 76 - 125
Target Start/End: Complemental strand, 22968026 - 22967977
Alignment:
| Q |
76 |
gtgatgacggagcatcatatgatattttttgctatgtttttagtactttt |
125 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
22968026 |
gtgatgacggagtatcatatgatattttaggctatgtttttagtagtttt |
22967977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 70 - 103
Target Start/End: Original strand, 12029545 - 12029578
Alignment:
| Q |
70 |
ggggttgtgatgacggagcatcatatgatatttt |
103 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
12029545 |
ggggttgtgatgaccgagcatcatatgatatttt |
12029578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 91 - 135
Target Start/End: Original strand, 30790727 - 30790771
Alignment:
| Q |
91 |
catatgatattttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
30790727 |
catataatattttttgctatgtttttagttattttatttgcattt |
30790771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 4e-17; HSPs: 7)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 70 - 135
Target Start/End: Original strand, 23223336 - 23223401
Alignment:
| Q |
70 |
ggggttgtgatgacggagcatcatatgatattttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |||||||||| ||||||||| || |||||| |
|
|
| T |
23223336 |
ggggttgtgatgacggagcatcatatgatgtttttggctatgttttaagtacttttctttgcattt |
23223401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 73 - 125
Target Start/End: Original strand, 30675411 - 30675463
Alignment:
| Q |
73 |
gttgtgatgacggagcatcatatgatattttttgctatgtttttagtactttt |
125 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
30675411 |
gttgtgatgacagagcatcatatgacattttttgctatgtttttagaactttt |
30675463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 78 - 135
Target Start/End: Complemental strand, 25778013 - 25777956
Alignment:
| Q |
78 |
gatgacggagcatcatatgatattttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||| ||||| || |||||| |
|
|
| T |
25778013 |
gatgacggagtatcatatgatattttttgctatgttcttagtgcttttctttgcattt |
25777956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 77 - 125
Target Start/End: Complemental strand, 12424097 - 12424050
Alignment:
| Q |
77 |
tgatgacggagcatcatatgatattttttgctatgtttttagtactttt |
125 |
Q |
| |
|
||||||| ||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
12424097 |
tgatgacagagcatcatatgata-ttttggctatgtttttagtactttt |
12424050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 77 - 135
Target Start/End: Complemental strand, 25730754 - 25730696
Alignment:
| Q |
77 |
tgatgacggagcatcatatgatatt-ttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||| ||||||||||||| || |||||| |
|
|
| T |
25730754 |
tgatgacagagcatcatatgatatttttttgctatg-ttttagtacttttctttgcattt |
25730696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 77 - 125
Target Start/End: Original strand, 12810256 - 12810302
Alignment:
| Q |
77 |
tgatgacggagcatcatatgatattttttgctatgtttttagtactttt |
125 |
Q |
| |
|
|||||||| |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
12810256 |
tgatgacgaagcatcat--gatattttttactatgtttttagtactttt |
12810302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 75 - 119
Target Start/End: Original strand, 26101987 - 26102031
Alignment:
| Q |
75 |
tgtgatgacggagcatcatatgatattttttgctatgtttttagt |
119 |
Q |
| |
|
|||||||| |||||||||||||||||||| || ||||||||||| |
|
|
| T |
26101987 |
tgtgatgatggagcatcatatgatattttaggcgatgtttttagt |
26102031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 2e-16; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 77 - 125
Target Start/End: Original strand, 12974270 - 12974318
Alignment:
| Q |
77 |
tgatgacggagcatcatatgatattttttgctatgtttttagtactttt |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12974270 |
tgatgacggagcatcatatgatattttttgctatggttttagtactttt |
12974318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 79 - 135
Target Start/End: Original strand, 30355260 - 30355316
Alignment:
| Q |
79 |
atgacggagcatcatatgatattttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| | |||||| |
|
|
| T |
30355260 |
atgacggagcatcatatgatatttttggctatgtttttagtacttttacttgcattt |
30355316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 78 - 125
Target Start/End: Complemental strand, 15576344 - 15576297
Alignment:
| Q |
78 |
gatgacggagcatcatatgatattttttgctatgtttttagtactttt |
125 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15576344 |
gatgatggagcatcatatgatatttttggctatgtttttagtactttt |
15576297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 70 - 125
Target Start/End: Original strand, 16527821 - 16527876
Alignment:
| Q |
70 |
ggggttgtgatgacggagcatcatatgatattttttgctatgtttttagtactttt |
125 |
Q |
| |
|
|||||||||||| | ||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
16527821 |
ggggttgtgatggcagagcatcatataatatttttggctatgtttttagtactttt |
16527876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 70 - 100
Target Start/End: Complemental strand, 1755742 - 1755712
Alignment:
| Q |
70 |
ggggttgtgatgacggagcatcatatgatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
1755742 |
ggggttgtgatgacggagcatcatatgatat |
1755712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 2e-16; HSPs: 8)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 71 - 135
Target Start/End: Complemental strand, 28278611 - 28278548
Alignment:
| Q |
71 |
gggttgtgatgacggagcatcatatgatattttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| || |||||| |
|
|
| T |
28278611 |
gggttgtgatgacagagcatcatatgatattttttgctatg-ttttagtacttttctttgcattt |
28278548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 76 - 135
Target Start/End: Complemental strand, 21505323 - 21505264
Alignment:
| Q |
76 |
gtgatgacggagcatcatatgatattttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |||| || |||||| |
|
|
| T |
21505323 |
gtgatgacggagcatcatatgatatttttggctatgtttttagtatttttctttgcattt |
21505264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 77 - 119
Target Start/End: Complemental strand, 18236485 - 18236443
Alignment:
| Q |
77 |
tgatgacggagcatcatatgatattttttgctatgtttttagt |
119 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18236485 |
tgatgacggagcatcatatgatattttatgctatgtttttagt |
18236443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 70 - 135
Target Start/End: Original strand, 31449882 - 31449947
Alignment:
| Q |
70 |
ggggttgtgatgacggagcatcatatgatattttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||| |||||||||||||| ||||||| |||||| |
|
|
| T |
31449882 |
ggggttgtgatgatggagtatcttatgatattttaagctatgtttttagttattttatttgcattt |
31449947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 70 - 119
Target Start/End: Original strand, 39730372 - 39730421
Alignment:
| Q |
70 |
ggggttgtgatgacggagcatcatatgatattttttgctatgtttttagt |
119 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
39730372 |
ggggttgtgatggcggagcatcatataatattttaggctatgtttttagt |
39730421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 70 - 116
Target Start/End: Original strand, 29769614 - 29769660
Alignment:
| Q |
70 |
ggggttgtgatgacggagcatcatatgatattttttgctatgttttt |
116 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
29769614 |
ggggttatgatgacggagcatcatataatattttaggctatgttttt |
29769660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 89 - 135
Target Start/End: Original strand, 32619586 - 32619632
Alignment:
| Q |
89 |
atcatatgatattttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||| || |||||| |
|
|
| T |
32619586 |
atcatatgatatttttggctatatttttagtacttttctttgcattt |
32619632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 89 - 125
Target Start/End: Complemental strand, 19949725 - 19949690
Alignment:
| Q |
89 |
atcatatgatattttttgctatgtttttagtactttt |
125 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19949725 |
atcatatgatatttttt-ctatgtttttagtactttt |
19949690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 8)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 76 - 135
Target Start/End: Complemental strand, 5906905 - 5906845
Alignment:
| Q |
76 |
gtgatgacggagcatcatatgatat-tttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
||||||||| | ||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
5906905 |
gtgatgacgaaacatcatatgatatatttttgctatgtttttagtacttttatttgcattt |
5906845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 80 - 135
Target Start/End: Complemental strand, 12111510 - 12111455
Alignment:
| Q |
80 |
tgacggagcatcatatgatattttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
|||| ||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
12111510 |
tgacagagcatcatatgacattttttgttatgtttttagtacttttatttgcattt |
12111455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 79 - 135
Target Start/End: Original strand, 15192137 - 15192193
Alignment:
| Q |
79 |
atgacggagcatcatatgatattttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
||||| ||||||||||||| |||||||| ||||||||| |||||||| || |||||| |
|
|
| T |
15192137 |
atgacagagcatcatatgacattttttgttatgtttttcgtacttttctttgcattt |
15192193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 70 - 125
Target Start/End: Complemental strand, 1676485 - 1676430
Alignment:
| Q |
70 |
ggggttgtgatgacggagcatcatatgatattttttgctatgtttttagtactttt |
125 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||| | ||| ||||| |||||||| |
|
|
| T |
1676485 |
ggggttgtgatgacgaagcatcatatgacatttttggttatattttttgtactttt |
1676430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 70 - 125
Target Start/End: Complemental strand, 1683013 - 1682958
Alignment:
| Q |
70 |
ggggttgtgatgacggagcatcatatgatattttttgctatgtttttagtactttt |
125 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||| | ||| ||||| |||||||| |
|
|
| T |
1683013 |
ggggttgtgatgacgaagcatcatatgacatttttggttatattttttgtactttt |
1682958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 70 - 119
Target Start/End: Original strand, 10576378 - 10576427
Alignment:
| Q |
70 |
ggggttgtgatgacggagcatcatatgatattttttgctatgtttttagt |
119 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||||||||||||| |
|
|
| T |
10576378 |
ggggttgtgatgatggagtatcatatgatattttagactatgtttttagt |
10576427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 85 - 125
Target Start/End: Complemental strand, 10320394 - 10320354
Alignment:
| Q |
85 |
gagcatcatatgatattttttgctatgtttttagtactttt |
125 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||| |||| |
|
|
| T |
10320394 |
gagcatcatatgacatttttcgctatgtttttagtaatttt |
10320354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 93 - 125
Target Start/End: Complemental strand, 34864458 - 34864426
Alignment:
| Q |
93 |
tatgatattttttgctatgtttttagtactttt |
125 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
34864458 |
tatgatattttttgttatgtttttagtactttt |
34864426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 11)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 70 - 128
Target Start/End: Complemental strand, 20471000 - 20470942
Alignment:
| Q |
70 |
ggggttgtgatgacggagcatcatatgatattttttgctatgtttttagtacttttatt |
128 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||| ||| ||||||||||||||||||| |
|
|
| T |
20471000 |
ggggttgtgatgacgaagcatcatatgaattttttggctttgtttttagtacttttatt |
20470942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 77 - 135
Target Start/End: Original strand, 29544451 - 29544509
Alignment:
| Q |
77 |
tgatgacggagcatcatatgatattttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||||| || |||| || |||||| |
|
|
| T |
29544451 |
tgatgaaggagcatcatatgatatttttggctatgtttttattaattttctttgcattt |
29544509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 77 - 137
Target Start/End: Original strand, 7142030 - 7142090
Alignment:
| Q |
77 |
tgatgacggagcatcatatgatattttttgctatgtttttagtacttttattcgcatttaa |
137 |
Q |
| |
|
||||||| ||||||||||||| |||||| |||||||||||| || |||| || |||||||| |
|
|
| T |
7142030 |
tgatgacagagcatcatatgacatttttggctatgtttttaatagttttctttgcatttaa |
7142090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 70 - 125
Target Start/End: Complemental strand, 9761595 - 9761541
Alignment:
| Q |
70 |
ggggttgtgatgacggagcatcatatgatattttttgctatgtttttagtactttt |
125 |
Q |
| |
|
|||||||||||||| ||||||||||||| | |||| |||| ||||||||||||||| |
|
|
| T |
9761595 |
ggggttgtgatgacagagcatcatatgaca-ttttggctacgtttttagtactttt |
9761541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 70 - 125
Target Start/End: Complemental strand, 9802054 - 9802000
Alignment:
| Q |
70 |
ggggttgtgatgacggagcatcatatgatattttttgctatgtttttagtactttt |
125 |
Q |
| |
|
|||||||||||||| ||||||||||||| | |||| |||| ||||||||||||||| |
|
|
| T |
9802054 |
ggggttgtgatgacagagcatcatatgaca-ttttggctacgtttttagtactttt |
9802000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 73 - 128
Target Start/End: Complemental strand, 22532830 - 22532775
Alignment:
| Q |
73 |
gttgtgatgacggagcatcatatgatattttttgctatgtttttagtacttttatt |
128 |
Q |
| |
|
||||| |||| |||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
22532830 |
gttgtaatgatggagcatcatatgatattttaggctatgtttttagttattttatt |
22532775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 77 - 124
Target Start/End: Original strand, 23124833 - 23124880
Alignment:
| Q |
77 |
tgatgacggagcatcatatgatattttttgctatgtttttagtacttt |
124 |
Q |
| |
|
|||||| |||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
23124833 |
tgatgatggagcatcatctgacattttttactatgtttttagtacttt |
23124880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 125
Target Start/End: Original strand, 7494638 - 7494691
Alignment:
| Q |
72 |
ggttgtgatgacggagcatcatatgatattttttgctatgtttttagtactttt |
125 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||| ||||||||||||| |
|
|
| T |
7494638 |
ggttgtgatgaatgagcatcacatgatatttttggctattcttttagtactttt |
7494691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 78 - 135
Target Start/End: Original strand, 18496498 - 18496555
Alignment:
| Q |
78 |
gatgacggagcatcatatgatattttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
||||| |||||| ||||||||||||| ||||||||||||||| |||| || |||||| |
|
|
| T |
18496498 |
gatgatggagcaccatatgatattttaggctatgtttttagtagttttctttgcattt |
18496555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 77 - 125
Target Start/End: Complemental strand, 21545984 - 21545933
Alignment:
| Q |
77 |
tgatgacggagcat---catatgatattttttgctatgtttttagtactttt |
125 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
21545984 |
tgatgacggagcatgatcatatgatatttttgactatgtttttagtactttt |
21545933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 79 - 119
Target Start/End: Complemental strand, 2353421 - 2353381
Alignment:
| Q |
79 |
atgacggagcatcatatgatattttttgctatgtttttagt |
119 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
2353421 |
atgacggagcatcgtatgatattttaggctatgtttttagt |
2353381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 71 - 125
Target Start/End: Original strand, 13911191 - 13911245
Alignment:
| Q |
71 |
gggttgtgatgacggagcatcatatgatattttttgctatgtttttagtactttt |
125 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||| |||||||||||||| |||| |
|
|
| T |
13911191 |
gggttgtgatgacggagaatcaaatgatatttttttctatgtttttagtaatttt |
13911245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 77 - 125
Target Start/End: Original strand, 17637035 - 17637083
Alignment:
| Q |
77 |
tgatgacggagcatcatatgatattttttgctatgtttttagtactttt |
125 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||| || ||||||| |
|
|
| T |
17637035 |
tgatgacggagcatcatatgacatttttggctatgtttatattactttt |
17637083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 72 - 135
Target Start/End: Original strand, 21017803 - 21017867
Alignment:
| Q |
72 |
ggttgtgatgacggagcatcatatgata-ttttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
||||||||| || ||||||||||||||| ||||||| ||||||||||||| |||| || |||||| |
|
|
| T |
21017803 |
ggttgtgataacagagcatcatatgatatttttttgttatgtttttagtatttttctttgcattt |
21017867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 70 - 117
Target Start/End: Complemental strand, 8402740 - 8402693
Alignment:
| Q |
70 |
ggggttgtgatgacggagcatcatatgatattttttgctatgttttta |
117 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
8402740 |
ggggttgtgatgacagagcatcatatgatattttagactatgttttta |
8402693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 178 - 241
Target Start/End: Complemental strand, 26892148 - 26892085
Alignment:
| Q |
178 |
ataacttcaaattacttgcattgttgagactaattaaagatctcatgttgagacaaccttgatc |
241 |
Q |
| |
|
|||| ||||||||| |||||||| ||| ||||||||||||| | |||||||| | ||||||||| |
|
|
| T |
26892148 |
ataatttcaaattatttgcattgctgacactaattaaagatttgatgttgaggccaccttgatc |
26892085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 77 - 125
Target Start/End: Complemental strand, 19219394 - 19219346
Alignment:
| Q |
77 |
tgatgacggagcatcatatgatattttttgctatgtttttagtactttt |
125 |
Q |
| |
|
|||||||| |||||||||||||| |||| ||| ||||||||||| |||| |
|
|
| T |
19219394 |
tgatgacgaagcatcatatgatacttttagctgtgtttttagtattttt |
19219346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 77 - 121
Target Start/End: Complemental strand, 25919647 - 25919603
Alignment:
| Q |
77 |
tgatgacggagcatcatatgatattttttgctatgtttttagtac |
121 |
Q |
| |
|
|||||| ||||||||||||||||||| | | |||||||||||||| |
|
|
| T |
25919647 |
tgatgatggagcatcatatgatatttctggttatgtttttagtac |
25919603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 77 - 125
Target Start/End: Original strand, 446937 - 446984
Alignment:
| Q |
77 |
tgatgacggagcatcatatgatattttttgctatgtttttagtactttt |
125 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
446937 |
tgatgacagagcatcatatgatatttt-tgctatgtttttagtactttt |
446984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0386 (Bit Score: 32; Significance: 0.000000009; HSPs: 2)
Name: scaffold0386
Description:
Target: scaffold0386; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 77 - 128
Target Start/End: Complemental strand, 8892 - 8841
Alignment:
| Q |
77 |
tgatgacggagcatcatatgatattttttgctatgtttttagtacttttatt |
128 |
Q |
| |
|
|||||| ||| ||||||||||||||||| | ||| ||||||||||||||||| |
|
|
| T |
8892 |
tgatgatggaacatcatatgatatttttggttatttttttagtacttttatt |
8841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0386; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 92 - 128
Target Start/End: Complemental strand, 13239 - 13203
Alignment:
| Q |
92 |
atatgatattttttgctatgtttttagtacttttatt |
128 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
13239 |
atatgatatttttagttatgtttttagtacttttatt |
13203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0282 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0282
Description:
Target: scaffold0282; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 70 - 135
Target Start/End: Complemental strand, 22735 - 22670
Alignment:
| Q |
70 |
ggggttgtgatgacggagcatcatatgatattttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
||||||||||||| || |||||||| |||||| ||||||||||| ||||||||||| |||||| |
|
|
| T |
22735 |
ggggttgtgatgatagaccatcatataccatttttggctatgttttttgtacttttatttgcattt |
22670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0188 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0188
Description:
Target: scaffold0188; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 86 - 135
Target Start/End: Complemental strand, 27128 - 27079
Alignment:
| Q |
86 |
agcatcatatgatattttttgctatgtttttagtacttttattcgcattt |
135 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||| || |||||| |
|
|
| T |
27128 |
agcatcacatgatattttcggctatgtttttagtacttttctttgcattt |
27079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0171 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0171
Description:
Target: scaffold0171; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 77 - 125
Target Start/End: Original strand, 6128 - 6176
Alignment:
| Q |
77 |
tgatgacggagcatcatatgatattttttgctatgtttttagtactttt |
125 |
Q |
| |
|
||||||| ||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
6128 |
tgatgacatagcatcatatggcatttttggctatgtttttagtactttt |
6176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University