View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_high_42 (Length: 387)
Name: NF1213_high_42
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_high_42 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 61 - 327
Target Start/End: Original strand, 43102613 - 43102875
Alignment:
| Q |
61 |
acttggcagcctcttattgatattatataaaggactatatatggggtcttgaggaaataaatatatcaacttgggaggtagggcggtcctcctaaatttg |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102613 |
acttggcagcctcttattgatattatataaaggactat----ggggtcttgaggaaataaatatatcaacttgggaggtagggcggtcctcctaaatttg |
43102708 |
T |
|
| Q |
161 |
gttatcatccatacatatcttccacttggttgtgtgccactgaggataggttgactatcaaagactatttaaggtttcatagcagcaaaatggtaggg-- |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102709 |
gttatcatccatacatatcttccacttggttgtgtgccactgaggataggttggctatcaaagactatttaaggtttcatagcagcaaaatggtagggta |
43102808 |
T |
|
| Q |
259 |
-tatgggagattggacagtactgggaggaagatgagtgtgtatgggagctctcgtggatgcaaacgttgt |
327 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102809 |
ttatgggagattggac---actgggaggaagatgagtgtgtatgggagctctcgtggatgcaaacgttgt |
43102875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 43102491 - 43102542
Alignment:
| Q |
1 |
tgtgtgtttattttaatgatgatttcctgggtatcgctaagcgttttcttta |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102491 |
tgtgtgtttattttaatgatgatttcctgggtatcgctaagcgttttcttta |
43102542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University