View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_high_45 (Length: 369)
Name: NF1213_high_45
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_high_45 |
 | |
|
| [»] scaffold0007 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 63 - 336
Target Start/End: Complemental strand, 49443914 - 49443634
Alignment:
| Q |
63 |
agtaatgtttattttttgttgagaaaatagtttgggatatatgtatatgcacgacgatgccctctcaagttctgtgtatgtagtgcattgtttg------ |
156 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49443914 |
agtaatgtttattttttgttgagagaatagtttgggatatatgtatatgcacgacgatgccctctcaagttctgtgtatgtagtgcattgtttgacgttt |
49443815 |
T |
|
| Q |
157 |
-ttatatgagaagtaagctggcaactaatgttatgaacgtatgtatgaagaggggatgaagtgaaaatgaactccagatagattttgcaacatgcttgat |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49443814 |
gttatatgagaagtaagctggcaactaatgttatgaacgtatgtatgaagaggggatgaagtgaaaatgaactccagatagattttgcaacatgcttgat |
49443715 |
T |
|
| Q |
256 |
gnnnnnnnagattttatcttgtacaagtaagaacaacccattacttgttgaaattaaaaccatgttgcacttattaggaaa |
336 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49443714 |
gtttttttagattttatcttgtacaagtaagaacaacccattacttgttgaaattaaaaccatgttgcacttattaggaaa |
49443634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 64 - 92
Target Start/End: Complemental strand, 149465 - 149437
Alignment:
| Q |
64 |
gtaatgtttattttttgttgagaaaatag |
92 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
149465 |
gtaatgtttattttttgttgagaaaatag |
149437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University