View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_high_54 (Length: 315)
Name: NF1213_high_54
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_high_54 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 195 - 315
Target Start/End: Original strand, 46524681 - 46524801
Alignment:
| Q |
195 |
gtagggttgacaatggacaagtttctttctactgaaggttaaaatccgatgggtttgcttccaactttagctctgaattgctaacttttcaacaaacagc |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46524681 |
gtagggttgacaatggacaagtttctttctactgaaggttaaaatccgatgggtttgcttccaactttagctcttaattgctaacttttcaacaaacagc |
46524780 |
T |
 |
| Q |
295 |
taggatttgttgtagggaagg |
315 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
46524781 |
taggatttgttgtagggaagg |
46524801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University