View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_high_58 (Length: 309)
Name: NF1213_high_58
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_high_58 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 88 - 309
Target Start/End: Original strand, 28984677 - 28984898
Alignment:
| Q |
88 |
cgtcataaatagaagctccattcagcagagcgccccaaactttagcagttggctcaaacggcatcttagaaatgaacttttccgcttctgagagctttcc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28984677 |
cgtcataaatagaagctccattcagcagagcgccccaaactttagcagttggctcaaacggcatcttagaaatgaacttttccgcttctgagagctttcc |
28984776 |
T |
 |
| Q |
188 |
agctcgactaagaacaccaaccatgcaggcatagtgctccaccacaggttgaatcccatgtttcgaaggcatcacgttgaaaacatcccaagcttcattc |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28984777 |
agctcgactaagaacaccaaccatgcaggcatagtgctccaccacaggttgaatcccatgtttcgaaggcatcgcgttgaaaacatcccaagcttcattc |
28984876 |
T |
 |
| Q |
288 |
accagcccggaatgagcacaag |
309 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
28984877 |
accagcccggaatgagcacaag |
28984898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University