View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_high_59 (Length: 306)
Name: NF1213_high_59
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_high_59 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 29 - 271
Target Start/End: Original strand, 27122854 - 27123097
Alignment:
| Q |
29 |
ataatatatgagtatatacaccataactaattgaaatatttatatagttcccctttgtattaagtttgtgcaatctttggcataagtcttccttatattt |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27122854 |
ataatatatgagtatatacaccataactaattgaaatatttatatagttcctctttgtattaagtttgtgcaatctttggcataagtctttcttatattt |
27122953 |
T |
 |
| Q |
129 |
ctggcataaataatttactttctttgcgttgctcttcaagtttgacc-ttatttattttttctgattccttaagtaaaaatctagagtatgtttcttgta |
227 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||||||||| |||||||||||| ||||||||| |||||||||| |||||||| ||||| ||| |
|
|
| T |
27122954 |
ctggcaaaaataatttactttctttgtgttgctcttcaagtttgacctttatttatttttcctgattcctcaagtaaaaatatagagtatctttctggta |
27123053 |
T |
 |
| Q |
228 |
attacaattgagatggaaaaatgactttatggagatttgataat |
271 |
Q |
| |
|
|||| |||| |||| | ||||||| ||||||||||||||||||| |
|
|
| T |
27123054 |
attataattcagattgcaaaatgattttatggagatttgataat |
27123097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University