View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_high_64 (Length: 292)
Name: NF1213_high_64
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_high_64 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 15 - 277
Target Start/End: Original strand, 40345916 - 40346178
Alignment:
| Q |
15 |
tatcatatgaggtcactttggttctaaggcgagatatagggacaccaatactgtannnnnnnattcattaannnnnnnagatagaagtgctctatcttct |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
40345916 |
tatcatatgaggtcactttggttctaaggcgagatatagggacaccaatactgtatttttttattcattaatttttttagatagaagtgctctatcttct |
40346015 |
T |
 |
| Q |
115 |
aattttataaaccctagattatgatgtgtatttgtctacctaaaggagtgtgtgcctttccttattatactaaattggggaggtttgcggagcggttgga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40346016 |
aattttataaaccctagattatgatgtgtatttgtctacctaaaggagtgtgtgcctttccttattatactaaattggggaggtttgcggagcggttgga |
40346115 |
T |
 |
| Q |
215 |
aacaagaccttgttaatgtctttctgaacaacataattcttgcgttatattcactcgtatgat |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40346116 |
aacaagaccttgttaatgtctttctgaacaacataattcttgcgttatattcactcgtatgat |
40346178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University