View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_high_67 (Length: 286)
Name: NF1213_high_67
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_high_67 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 65 - 269
Target Start/End: Original strand, 40345486 - 40345690
Alignment:
| Q |
65 |
attatttaaggacctgtaaatacttgctgaaagaaatttaatctctttgttgcagcaatcgagatctttccatgatccttgacgctcttctcaaaacaaa |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40345486 |
attatttaaggacctgtaaatacttgctgaaagaaatttaatctctttgttgcagcaatcgagatctttccatgatccttgacgctcttctcaaaacaaa |
40345585 |
T |
 |
| Q |
165 |
atctagagctgtgctgaatgatataattagtaaaaatggtaatctatacttgctttgaatttaatgaaaattttctcctatttatcaggaacgttagacc |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40345586 |
atctagagctgtgctgaatgatataattagtaaaaatggtaatctatacttgctttgcatttaatgaaaattttctcccatttatcaggaacgttagacc |
40345685 |
T |
 |
| Q |
265 |
tatga |
269 |
Q |
| |
|
|||| |
|
|
| T |
40345686 |
catga |
40345690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University