View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_high_68 (Length: 285)
Name: NF1213_high_68
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_high_68 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 41531764 - 41531801
Alignment:
| Q |
1 |
aaagtgtctttttacaatttaatttgttgttattttcc |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41531764 |
aaagtgtctttttacaatttaatttgttgttattttcc |
41531801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 107 - 142
Target Start/End: Original strand, 41531870 - 41531905
Alignment:
| Q |
107 |
tctttaacattgatgtttgatatccagtatgatgat |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
41531870 |
tctttaacattgatgtttgatatccagtatgatgat |
41531905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 241 - 285
Target Start/End: Original strand, 41531751 - 41531795
Alignment:
| Q |
241 |
ttgttataaatttaaagtgtccttttacaatttaatttgttgtta |
285 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41531751 |
ttgttatttatttaaagtgtctttttacaatttaatttgttgtta |
41531795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University