View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_high_70 (Length: 285)
Name: NF1213_high_70
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_high_70 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 166
Target Start/End: Original strand, 41531844 - 41532009
Alignment:
| Q |
1 |
atatgtttacagtcttataaaatatttctttaacattgatgtttgatatccagtatgatgattttcaaaaaatatttcaccgatttttggtcttgaaagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41531844 |
atatgtttacagtcttataaaatatttctttaacattgatgtttgatatccagtatgatgattttcataaaatatttcaccgatttttggtcttgaaagc |
41531943 |
T |
 |
| Q |
101 |
accaaatattaaactaaacatcaaatgaaaattttgtatggactaaacatagtatgagaataatcc |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41531944 |
accaaatattaaactaaacatcaaatgaaaattttgtatggactaaacatagtatgagaataatcc |
41532009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 190 - 276
Target Start/End: Original strand, 41532028 - 41532114
Alignment:
| Q |
190 |
catagtatgagaagttcacaacacatcatccttagaaatattttgtcacagtaagatcgttcgtgaaaaaatgagtgatagtataat |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41532028 |
catagtatgagaagttcacaacacatcatccttagaaatattttgtcacagtaagattgttcgtgaaaaaatgagtgatagtataat |
41532114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University