View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_high_77 (Length: 262)
Name: NF1213_high_77
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_high_77 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 166
Target Start/End: Complemental strand, 30276629 - 30276464
Alignment:
| Q |
1 |
ccgccaagcgaattagaagctcttatcaatgatgtttcagaaaaactggatattctcatgtcagaaaacaaactagatgaagccttacaactcctagaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
30276629 |
ccgccaagcgaattagaagctcttatcaatgatgtttcagaaaaactggatattctcatgtcagaaaacaaactagatgaagccttacaactcctagagt |
30276530 |
T |
|
| Q |
101 |
ctgcatatgaagatgaatccctaactaatagtgatgatgagataatcttatataacactatgattt |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30276529 |
ctgcatatgaagatgaatccctaactaatagtgatgatgagataatcttatataacactatgattt |
30276464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University