View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1213_high_80 (Length: 261)

Name: NF1213_high_80
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1213_high_80
NF1213_high_80
[»] chr5 (2 HSPs)
chr5 (10-96)||(41532028-41532114)
chr5 (218-261)||(41531868-41531911)


Alignment Details
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 10 - 96
Target Start/End: Complemental strand, 41532114 - 41532028
Alignment:
10 attatactatcactcattttttcacgaacgatcttactgtgacaaaatatttctaaggatgatgtgttgtgaacttctcatactatg 96  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41532114 attatactatcactcattttttcacgaacaatcttactgtgacaaaatatttctaaggatgatgtgttgtgaacttctcatactatg 41532028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 218 - 261
Target Start/End: Complemental strand, 41531911 - 41531868
Alignment:
218 atgaaaatcatcatactggatatcaaacatcaatgttaaagaaa 261  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
41531911 atgaaaatcatcatactggatatcaaacatcaatgttaaagaaa 41531868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University