View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_high_81 (Length: 261)
Name: NF1213_high_81
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_high_81 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 10 - 96
Target Start/End: Complemental strand, 41532114 - 41532028
Alignment:
| Q |
10 |
attatactatcactcattttttcacgaacgatcttactgtgacaaaatatttctaaggatgatgtgttgtgaacttctcatactatg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41532114 |
attatactatcactcattttttcacgaacaatcttactgtgacaaaatatttctaaggatgatgtgttgtgaacttctcatactatg |
41532028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 218 - 261
Target Start/End: Complemental strand, 41531911 - 41531868
Alignment:
| Q |
218 |
atgaaaatcatcatactggatatcaaacatcaatgttaaagaaa |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41531911 |
atgaaaatcatcatactggatatcaaacatcaatgttaaagaaa |
41531868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University