View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_high_86 (Length: 249)
Name: NF1213_high_86
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_high_86 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 80; Significance: 1e-37; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 91 - 202
Target Start/End: Complemental strand, 22627642 - 22627531
Alignment:
| Q |
91 |
aagtatgttggtggctaaaaattcacctttctcaaggtgaataagccgtagagtgttctgcataaattatgtattgtttctaatcctaccaagacaaggt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||| |||||||||| |||||||||||| |||||||||||||||||| ||||| ||| |
|
|
| T |
22627642 |
aagtatgttggtggctaaaaattcacctttttcaaggtaaataagctgtagagtgttatgcataaattataaattgtttctaatcctaccgagacatggt |
22627543 |
T |
 |
| Q |
191 |
aaattttcttgg |
202 |
Q |
| |
|
|||||||||||| |
|
|
| T |
22627542 |
aaattttcttgg |
22627531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 32 - 88
Target Start/End: Complemental strand, 22627770 - 22627714
Alignment:
| Q |
32 |
cgaatgtgctacacccatttctagaatacttcaaaaaatgttgtttttcaaatttta |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22627770 |
cgaatgtgctacacccatttctagaatacttgaaaaaatgttgtttttcaaatttta |
22627714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 201 - 241
Target Start/End: Complemental strand, 22627509 - 22627469
Alignment:
| Q |
201 |
ggtgtaacaatatttaatctaaactgaatcatatgtagtgt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22627509 |
ggtgtaacaatatttaatctaaactgaatcatatgtggtgt |
22627469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University