View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_high_88 (Length: 248)
Name: NF1213_high_88
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_high_88 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 2 - 134
Target Start/End: Original strand, 33757673 - 33757804
Alignment:
| Q |
2 |
ggatgtccaataatatttttcctattccttatattcatatatgacttttgctatagnnnnnnnnnntagtctaaatgcattaaggtgtatatggattatg |
101 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33757673 |
ggatatccaagaatatttttcctattccttatattcatatatgacttttgctatagaaaaaaaaa-tagtctaaatgcattaaggtgtatatggattatg |
33757771 |
T |
 |
| Q |
102 |
ataccaacaatagtttggtgacaactaggtttt |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33757772 |
ataccaacaatagtttggtgacaactaggtttt |
33757804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University