View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_high_89 (Length: 246)
Name: NF1213_high_89
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_high_89 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 20368934 - 20368689
Alignment:
| Q |
1 |
tcgtataatatccgcacccatatcacatattcgagcttcatagtatagaaggaatgtcatttgggcataaaactagtttaattttatagggagaaatgag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20368934 |
tcgtataatatccgcacccatatcacatattcgggcttcatagtatggaagtaatgtcatttgggcataaaattagtttaattttatagggagaaatgag |
20368835 |
T |
 |
| Q |
101 |
gctttgaggaggccatacagtttattaaaccctttaagatggaaaattatagatgcaaagattgagcttgtgtccggtccgaaatattaggaaaggatga |
200 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||| ||||||| |||||| ||||||||||||| |||| ||| ||||||||||||||| |
|
|
| T |
20368834 |
gctttgaggaggccatacggtttgttaaaccctttaagatggaaaactatagatacaaagactgagcttgtgtccagtcccaaacattaggaaaggatga |
20368735 |
T |
 |
| Q |
201 |
tgaaaacaatacaaacattgtgaaaaggtttatgaagaaacaaaaa |
246 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
20368734 |
tgaaaacaatacaaaccttgtgaaaaggtttatgaagaaacaaaaa |
20368689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University