View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_high_97 (Length: 232)
Name: NF1213_high_97
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_high_97 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 28 - 135
Target Start/End: Complemental strand, 8431686 - 8431579
Alignment:
| Q |
28 |
ggttgctgctgtctttttggtgtggtgctgcagttttggctgttatgagtgttgatgcaggggtatgcttgcggattgtcatttgtatatgtctgcgtca |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8431686 |
ggttgctgctgtctttttggtgtggtgctgtagttttggctgttatgagtgttgatgcaggggtatgcttgcggattgtcatttgtatatgtctgcgtca |
8431587 |
T |
|
| Q |
128 |
ttattttt |
135 |
Q |
| |
|
|| ||||| |
|
|
| T |
8431586 |
tttttttt |
8431579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 86 - 136
Target Start/End: Original strand, 31833817 - 31833867
Alignment:
| Q |
86 |
aggggtatgcttgcggattgtcatttgtatatgtctgcgtcattatttttg |
136 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
31833817 |
aggggtatgcttgcggattgccatttgtatatgtctgcgtcattacttttg |
31833867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 76 - 130
Target Start/End: Original strand, 19472716 - 19472770
Alignment:
| Q |
76 |
gtgttgatgcaggggtatgcttgcggattgtcatttgtatatgtctgcgtcatta |
130 |
Q |
| |
|
||||||||||||||||||||||| || ||||| ||||||||| ||||||||||| |
|
|
| T |
19472716 |
gtgttgatgcaggggtatgcttgtggtctgtcacttgtatatgcctgcgtcatta |
19472770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 76 - 130
Target Start/End: Complemental strand, 30655815 - 30655761
Alignment:
| Q |
76 |
gtgttgatgcaggggtatgcttgcggattgtcatttgtatatgtctgcgtcatta |
130 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||||||| | ||||||||| |
|
|
| T |
30655815 |
gtgttgacgcaggggtatgcttgtggattgtcatttgtatatgccggcgtcatta |
30655761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 76 - 130
Target Start/End: Original strand, 11546685 - 11546739
Alignment:
| Q |
76 |
gtgttgatgcaggggtatgcttgcggattgtcatttgtatatgtctgcgtcatta |
130 |
Q |
| |
|
||||||| |||||||||| | || |||||||||| |||||||||||||||||||| |
|
|
| T |
11546685 |
gtgttgacgcaggggtattcatgaggattgtcatatgtatatgtctgcgtcatta |
11546739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 76 - 130
Target Start/End: Original strand, 34761080 - 34761134
Alignment:
| Q |
76 |
gtgttgatgcaggggtatgcttgcggattgtcatttgtatatgtctgcgtcatta |
130 |
Q |
| |
|
||||||| |||||||||| | || |||||||||| |||||||| ||||||||||| |
|
|
| T |
34761080 |
gtgttgacgcaggggtattcatgaggattgtcatatgtatatgcctgcgtcatta |
34761134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University