View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_low_103 (Length: 245)
Name: NF1213_low_103
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_low_103 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 37808385 - 37808477
Alignment:
| Q |
1 |
tttaaaaatgtatctcttaaatttacactcgtgcccttaatggatatatagataatttgatgaattgatttcccaacaaaatcattcttcact |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37808385 |
tttaaaaatgtatctcttaaatttacactcgtgcccttaatggatatatagataatttgatgaattgatttcccaacaaaatcattcttcact |
37808477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 192 - 240
Target Start/End: Original strand, 37808577 - 37808625
Alignment:
| Q |
192 |
gcatcattaacccaaaaagctcaagaactcaaaagtttgaacacctatg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37808577 |
gcatcattaacccaaaaagctcaagaactcaaaagtttgaacacctatg |
37808625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 199 - 232
Target Start/End: Complemental strand, 19619078 - 19619045
Alignment:
| Q |
199 |
taacccaaaaagctcaagaactcaaaagtttgaa |
232 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
19619078 |
taacccaagaagctcaagaactcaaaagtttgaa |
19619045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University