View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_low_107 (Length: 240)
Name: NF1213_low_107
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_low_107 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 110 - 217
Target Start/End: Original strand, 33757828 - 33757936
Alignment:
| Q |
110 |
gagaggaactagattttctttcgttttgttgaaataactaggnnnnnnnnn-ctcacttgtgttattacatatatccacatatggtgtgaggtcatgggc |
208 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
33757828 |
gagaggaactagattttcttttgttttgttgaaataactaggttttttttttctcacttgtgttattacatatatccacatgtggtgtgcggtcatgggc |
33757927 |
T |
 |
| Q |
209 |
tatataata |
217 |
Q |
| |
|
||||||||| |
|
|
| T |
33757928 |
tatataata |
33757936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 22 - 84
Target Start/End: Original strand, 33757738 - 33757800
Alignment:
| Q |
22 |
tagtctaaatgtattaaggtgtatatggattatgataccaacaatagtttggtgacaactagg |
84 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33757738 |
tagtctaaatgcattaaggtgtatatggattatgataccaacaatagtttggtgacaactagg |
33757800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University