View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_low_115 (Length: 219)
Name: NF1213_low_115
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_low_115 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 25860910 - 25861025
Alignment:
| Q |
1 |
tagcaaagttgactggactaaaatatattttgaaaactatgaattagttgagaatggcttaagaacaaactactttggaaccaaagaattaactagaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25860910 |
tagcaaagttgactggactaaaatatattttgaaaactatgaattagttgagaaaggcctaagaacaaactattttggaaccaaagaattaactagaatt |
25861009 |
T |
 |
| Q |
101 |
ctgattccccttcttc |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
25861010 |
ctgattccccttcttc |
25861025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University