View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_low_117 (Length: 204)
Name: NF1213_low_117
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_low_117 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 37931109 - 37931324
Alignment:
| Q |
1 |
attgattccaagaggtgaatttatcaatatccattaactggagtatagacgtctcatgtcccaaaaagatgcgagcattatagaatcttcacaatgacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37931109 |
attgattccaagaggtgaatttatcaatatccattaactggagtatagacgtctcatgtcccaaaaagatgcgagcattatagaatcttcacaatgacat |
37931208 |
T |
 |
| Q |
101 |
gcaacagattgccatactaataagaaaactaaagagtttccctctgaatattgttaa------------gatttgagtttgaattatattttgttgttct |
188 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37931209 |
gcaacagattgccatactaataagaaacctaaagagtttccctctgaatattgttaagatattgcatatgatttgagtttgaattatattttgttgttct |
37931308 |
T |
 |
| Q |
189 |
tatccctataatcaaa |
204 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
37931309 |
tatccctataatcaaa |
37931324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 6 - 76
Target Start/End: Complemental strand, 12760398 - 12760328
Alignment:
| Q |
6 |
ttccaagaggtgaatttatcaatatccattaactggagtatagacgtctcatgtcccaaaaagatgcgagc |
76 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||| | | ||||||| | |||||||| ||| |||| |
|
|
| T |
12760398 |
ttccaagaggtgaatttaacaatatccactaactggagcacaaacgtctccttccccaaaaatatgtgagc |
12760328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University