View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_low_23 (Length: 485)
Name: NF1213_low_23
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-106; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 41 - 240
Target Start/End: Complemental strand, 39902444 - 39902245
Alignment:
| Q |
41 |
gaacctgtgggaaagttgtagtttgaagctttgagaagagattgatgaagttgttaggactatatatcaacattatgcattcctcaatcaatggcaatgg |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39902444 |
gaacctgtgggaaagttgtagtttgaagctttgagaagagattgatgaagttgttaggactatatatcaacattatgcattcctcaatcaatggcaatgg |
39902345 |
T |
 |
| Q |
141 |
atgagattgcaagactcaaacacgattgtagcttggccacgggtagatttggtcaaatggatcatacctccaaacaggttgaaaagcaatattgaggtag |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39902344 |
atgagattgcaagactcaaacacgattgtagcttggccacgggtagatttggtcaaatggatcatacctccaaacaggttgaaaagcaatattgatgtag |
39902245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 293 - 354
Target Start/End: Complemental strand, 39902097 - 39902036
Alignment:
| Q |
293 |
atgaggttgaagatgttgattttaaacttgatgcataaattttatcttattttggttggttt |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39902097 |
atgaggttgaagatgttgattttaaacttgatgcataaattttatcttattttggttggttt |
39902036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 237 - 271
Target Start/End: Complemental strand, 39902147 - 39902113
Alignment:
| Q |
237 |
gtagaagaggcgtaggctcatgggttcactaaaag |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
39902147 |
gtagaagaggcgtaggctcatgggttcactaaaag |
39902113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 264 - 297
Target Start/End: Complemental strand, 39902012 - 39901979
Alignment:
| Q |
264 |
actaaaaggcaaactaattattacatttcatgag |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
39902012 |
actaaaaggcaaactaattattacatttcatgag |
39901979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University