View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_low_57 (Length: 355)
Name: NF1213_low_57
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_low_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 30 - 344
Target Start/End: Complemental strand, 46680712 - 46680388
Alignment:
| Q |
30 |
gaattaaagctgaaagttt--atgaatattaatttgttgcagaaatagaaatatttatgaaagcaaggtagtaggatttagttggtttgttagatt---- |
123 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46680712 |
gaattaaagctgaaagtttttatgaatattaatttgttgcagaaatagaaatatttatgaaagcaaggtagtaggatttagttggtttgttagattagat |
46680613 |
T |
 |
| Q |
124 |
-gcattgtactataaaattgtatttataggagtttttagattgcattgcagagtatggcatggatatatgatgttgactgtgtctcaaactttc---gtc |
219 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
46680612 |
tgcattctactataaaattgtatttataggagtttttagattgcattggagagtatggcatggatatatgatgttgactgtgtctcaaactgtctcagtc |
46680513 |
T |
 |
| Q |
220 |
aaagatgcgcgcatgccttcaatattatattatgtcgtctctgctatggtccaaagactggttcagagttacttggttttggtattataaggcaaaccaa |
319 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46680512 |
aaagatgcgcgcgtgccttcaatattatattatgtcgtctctgctatggtccaaagactggttcagagttacttggttttggtattataaggcaaaccaa |
46680413 |
T |
 |
| Q |
320 |
aagggatcaaaagtttaagagtata |
344 |
Q |
| |
|
|||||||||||||||| |||||||| |
|
|
| T |
46680412 |
aagggatcaaaagtttcagagtata |
46680388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University