View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_low_63 (Length: 315)
Name: NF1213_low_63
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_low_63 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 2e-34; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 164 - 238
Target Start/End: Complemental strand, 37814529 - 37814455
Alignment:
| Q |
164 |
ttaaaactatatttaatctatcaatgcccatattttctttatggcatttacaacaatgtacttaaaattgatatt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37814529 |
ttaaaactatatttaatctatcaatgcccatattttctttatggcatttacaacaatgtacttaaaattgatatt |
37814455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 94 - 147
Target Start/End: Complemental strand, 37814608 - 37814555
Alignment:
| Q |
94 |
cctatatttatgttataatatctgcatttaaaaaattgaaatatcacttttgat |
147 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37814608 |
cctatatatatgttataatatctgcatttaaaaaattgaaatatcacttttgat |
37814555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University