View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1213_low_63 (Length: 315)

Name: NF1213_low_63
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1213_low_63
NF1213_low_63
[»] chr3 (2 HSPs)
chr3 (164-238)||(37814455-37814529)
chr3 (94-147)||(37814555-37814608)


Alignment Details
Target: chr3 (Bit Score: 75; Significance: 2e-34; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 164 - 238
Target Start/End: Complemental strand, 37814529 - 37814455
Alignment:
164 ttaaaactatatttaatctatcaatgcccatattttctttatggcatttacaacaatgtacttaaaattgatatt 238  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37814529 ttaaaactatatttaatctatcaatgcccatattttctttatggcatttacaacaatgtacttaaaattgatatt 37814455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 94 - 147
Target Start/End: Complemental strand, 37814608 - 37814555
Alignment:
94 cctatatttatgttataatatctgcatttaaaaaattgaaatatcacttttgat 147  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
37814608 cctatatatatgttataatatctgcatttaaaaaattgaaatatcacttttgat 37814555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University