View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1213_low_65 (Length: 315)

Name: NF1213_low_65
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1213_low_65
NF1213_low_65
[»] chr4 (1 HSPs)
chr4 (195-315)||(46524681-46524801)


Alignment Details
Target: chr4 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 195 - 315
Target Start/End: Original strand, 46524681 - 46524801
Alignment:
195 gtagggttgacaatggacaagtttctttctactgaaggttaaaatccgatgggtttgcttccaactttagctctgaatttctaacttttcaacaaacagc 294  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||    
46524681 gtagggttgacaatggacaagtttctttctactgaaggttaaaatccgatgggtttgcttccaactttagctcttaattgctaacttttcaacaaacagc 46524780  T
295 taggatttgttgtagggaagg 315  Q
    |||||||||||||||||||||    
46524781 taggatttgttgtagggaagg 46524801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University