View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1213_low_74 (Length: 292)

Name: NF1213_low_74
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1213_low_74
NF1213_low_74
[»] chr3 (1 HSPs)
chr3 (15-277)||(40345916-40346178)


Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 15 - 277
Target Start/End: Original strand, 40345916 - 40346178
Alignment:
15 tatcatatgaggtcactttggttctaaggcgagatatagggacaccaatactgtannnnnnnattcattaannnnnnnagatagaagtgctctatcttct 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||       ||||||||||||||||||||||    
40345916 tatcatatgaggtcactttggttctaaggcgagatatagggacaccaatactgtatttttttattcattaatttttttagatagaagtgctctatcttct 40346015  T
115 aattttataaaccctagattatgatgtgtatttgtctacctaaaggagtgtgtgcctttccttattatactaaattggggaggtttgcggagcggttgga 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40346016 aattttataaaccctagattatgatgtgtatttgtctacctaaaggagtgtgtgcctttccttattatactaaattggggaggtttgcggagcggttgga 40346115  T
215 aacaagaccttgttaatgtctttctgaacaacataattcttgcgttatattcactcgtatgat 277  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40346116 aacaagaccttgttaatgtctttctgaacaacataattcttgcgttatattcactcgtatgat 40346178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University