View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_low_86 (Length: 264)
Name: NF1213_low_86
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_low_86 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 42 - 197
Target Start/End: Original strand, 7892611 - 7892766
Alignment:
| Q |
42 |
cttttgtgatgccgaaaaccgcgcttcttcaagctcatcactttgatatcaagggtgtttttagaactgattttcctgataagcctttggctccttttaa |
141 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7892611 |
cttttgtcatgccgaaaaccgcgcttcttcaagctcatcactttgatatcaagggtgtttttagaactgattttccagataagcctttggctccttttaa |
7892710 |
T |
|
| Q |
142 |
ctatactggcgcaccgttgaccgccaatctcggtactaagacgggaacaagagtta |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7892711 |
ctatactggcgcaccgttgaccgccaatctcggtactaagacgggaacaagagtta |
7892766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 42 - 120
Target Start/End: Original strand, 7902881 - 7902959
Alignment:
| Q |
42 |
cttttgtgatgccgaaaaccgcgcttcttcaagctcatcactttgatatcaagggtgtttttagaactgattttcctga |
120 |
Q |
| |
|
||||||||||||| ||| |||||||| |||||||| |||| | |||||||||||||| ||| ||||||||||||| |
|
|
| T |
7902881 |
cttttgtgatgcctcaaattgcgcttctccaagctcactacttcaacatcaagggtgttttcagagctgattttcctga |
7902959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University