View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_low_89 (Length: 261)
Name: NF1213_low_89
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_low_89 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 69 - 130
Target Start/End: Complemental strand, 39902097 - 39902036
Alignment:
| Q |
69 |
atgaggttgaagatgttgattttaaacttgatgcataaattttatcttattttggttggttt |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39902097 |
atgaggttgaagatgttgattttaaacttgatgcataaattttatcttattttggttggttt |
39902036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 40 - 73
Target Start/End: Complemental strand, 39902012 - 39901979
Alignment:
| Q |
40 |
actaaaaggcaaactaattattacatttcatgag |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
39902012 |
actaaaaggcaaactaattattacatttcatgag |
39901979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University