View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_low_93 (Length: 251)
Name: NF1213_low_93
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_low_93 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 25861407 - 25861649
Alignment:
| Q |
1 |
ttcacatgaaaccaaaggttggcctcaatcaaattctgcatacattgtctcaaaagttgctcttaatgcctacacaagagttcttgccaagaagtaccct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25861407 |
ttcacatgaaaccaaaggttggcctcaatcaaattctgcatacattgtttcaaaagttgctcttaacgcctacacaagagttcttgccaagaagtaccct |
25861506 |
T |
 |
| Q |
101 |
tctttttcgataaatgctatttctcctggttttgtcaaaactgatatgactcatggtaatggtgctctaacatctgatgaaggtgctgaacctattgtga |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25861507 |
tctttttcgataaatgctatttcccctggttttgtgaaaactgatatgactcatggtaatggtgctctaacatctgatgaaggtgctgaacctattgtga |
25861606 |
T |
 |
| Q |
201 |
aactggcactacaagatggtagtccttccggtctcttcttctc |
243 |
Q |
| |
|
|| ||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
25861607 |
aattggcactacaagatggtagtccttctggtctctttttctc |
25861649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University