View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_low_97 (Length: 250)
Name: NF1213_low_97
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_low_97 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 13 - 250
Target Start/End: Complemental strand, 28985127 - 28984890
Alignment:
| Q |
13 |
aatatatacgtggcaactgccattgttgatagttatgcaaagttagggtttattcatttggcaaggcgggtttttgatcagtcacaaagtaggagcttga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28985127 |
aatatatacgtggcaactgccattgttgatagttatgcaaagttagggtttattcatttggcaaggcgggtttttgatcagtcacaaagtaggagcttga |
28985028 |
T |
|
| Q |
113 |
taatttggacttcaattatatatgcttatgcttctcatggagatgctagtttagcacttggtctctataaccagatgttagatagaggaattcagcctga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28985027 |
taatttggacttcaattatatatgcttatgcttctcacggagatgctagtttagcacttggtctctataaccagatgttagatagaggaattcagcctga |
28984928 |
T |
|
| Q |
213 |
cccagttacattgacttctgtgttgacagcttgtgctc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28984927 |
cccagttacattgacttctgtgttgacagcttgtgctc |
28984890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University