View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1213_low_98 (Length: 249)
Name: NF1213_low_98
Description: NF1213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1213_low_98 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 54 - 249
Target Start/End: Original strand, 22626547 - 22626742
Alignment:
| Q |
54 |
atatttgtgttttacgaccaatgcatcattgtttttgtacacttcaaaagtttcacattgcttgaaagttgatgtcaaggtagtttatatataacacata |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| | |||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
22626547 |
atatttgtgttttacgaccaatgcatcattgtttttttacacataaaaagtttcacattgcttgaaagttgatgttaaggtagtttatatataaaacata |
22626646 |
T |
|
| Q |
154 |
ttctttcgccaacgagacgtcttttacaaaggacaaaaccgtgatgggtttatattcagagcggacaatatatcagaacggggtgtaaggtgctaa |
249 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
22626647 |
ttctttcaccaacgagacgtcttttacaaagggcaaaatcgtgaagggtttatattcagagcggacaatatatcagaacggggtgtgacgtgctaa |
22626742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University