View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12140_low_10 (Length: 243)
Name: NF12140_low_10
Description: NF12140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12140_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 95 - 225
Target Start/End: Original strand, 17856629 - 17856766
Alignment:
| Q |
95 |
tgattttaaaaactgtttttacagacatatgctattatcgtattacagtgaagtatgatgaaaatgttcgtcgtgttttttaatagaataatgccatgct |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17856629 |
tgattttaaaaactgtttttacagacatatgctattatcgtattacagtgaagtatgatgaaaatgttcgtcgtgttttttaatagaataatgccatgct |
17856728 |
T |
 |
| Q |
195 |
tt-------tgatatatcagtaagttgcttatcctgtt |
225 |
Q |
| |
|
|| ||||||||| ||||||||||||||||||| |
|
|
| T |
17856729 |
ttatcttactgatatatcggtaagttgcttatcctgtt |
17856766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 6 - 85
Target Start/End: Original strand, 17855952 - 17856031
Alignment:
| Q |
6 |
gctaaagggggccagaaacactgtaaatagaacccctgggttcattcccaaatcaagacctaaccagatacaaaaaccta |
85 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17855952 |
gctatagggggccagaaacactgtaaatagaacccctgggttcattcccaaatcaagacctaaccagatacaaaaaccta |
17856031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University