View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12141_high_4 (Length: 246)
Name: NF12141_high_4
Description: NF12141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12141_high_4 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 9 - 246
Target Start/End: Complemental strand, 55427908 - 55427671
Alignment:
| Q |
9 |
cagaacctgtgcacggtggagcgttcgtgcgaaagattgtcaatttagattggagatcatatattcggtttttgaattggatgccggctgcacttagaat |
108 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55427908 |
cagatcctgtgcacggtggagcgttcatgcgaaagattgtcaatttagattggagatcatatattcggtttttgaattggatgccggctgcacttagaat |
55427809 |
T |
|
| Q |
109 |
gccggaacctgagcttattgaccatgctggattggactctgttgtttacttgaggatttacttgttagggtatgatcatcaataattatggacagcgttt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
55427808 |
gccggaacctgagcttattgaccatgctggattggactctgctgtttacttgaggatttacttgttagggtatgatcatcaatcattatggacagcgttt |
55427709 |
T |
|
| Q |
209 |
gaatataccatattggagaatatgctcactgatgtttt |
246 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
55427708 |
gaatataccatattggagaatatgatcactgatgtttt |
55427671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 171
Target Start/End: Original strand, 37418404 - 37418500
Alignment:
| Q |
75 |
ggtttttgaattggatgccggctgcacttagaatgccggaacctgagcttattgaccatgctggattggactctgttgtttacttgaggatttactt |
171 |
Q |
| |
|
|||| ||||| |||||||| |||||| | |||||||||||| || || ||||| ||||| || ||||| |||| ||| ||||||||||| ||||| |
|
|
| T |
37418404 |
ggttcttgaactggatgcctgctgcattgcaaatgccggaacccgaactaattgaacatgcaggcttggattctgctgtatacttgaggatctactt |
37418500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University