View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12142_high_15 (Length: 272)
Name: NF12142_high_15
Description: NF12142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12142_high_15 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 8 - 272
Target Start/End: Original strand, 2465748 - 2465995
Alignment:
| Q |
8 |
tatattaatactatgagaacaaagaaataggacataaaacata---catcctaagaaaagtgtaagttgggaaattgcaaaggcttatacaaaactcttt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2465748 |
tatattaatactatgagaacaaagaaataggacataaaacatagtacatcctaagaaaagtgtaagttgggaaattgcaaaggct-atacaaaactcttt |
2465846 |
T |
 |
| Q |
105 |
gattggtaatgatcccctattagttgatgcataacttccaaaagagaaccgactttccgtcttcttccagaatttagaattcaaaaagtcagtacttgat |
204 |
Q |
| |
|
||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2465847 |
gataggtaatgatcccctattagttgatgca-------------------gactttccgtcttcttccagaatttagaattcaaaaagtcagtacatgat |
2465927 |
T |
 |
| Q |
205 |
agcttgcaacacatgtcttgtacggcatcagtattaggaatcatttatgaaaacaacttatatcttat |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2465928 |
agcttgcaacacatgtcttgtacggcatcagtattaggaatcatttatgaaaacaacttatagcttat |
2465995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 152 - 246
Target Start/End: Complemental strand, 16131056 - 16130962
Alignment:
| Q |
152 |
accgactttccgtcttcttccagaatttagaattcaaaaagtcagtacttgatagcttgcaacacatgtcttgtacggcatcagtattaggaatc |
246 |
Q |
| |
|
||||||| || ||||||||||||||||||||| ||||||||||||||| | |||||||||||||||||| | || |||||||||||| |||||| |
|
|
| T |
16131056 |
accgactgtctgtcttcttccagaatttagaactcaaaaagtcagtaccaggtagcttgcaacacatgtcgtctatggcatcagtattgggaatc |
16130962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University