View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12142_high_23 (Length: 240)
Name: NF12142_high_23
Description: NF12142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12142_high_23 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 2176806 - 2176583
Alignment:
| Q |
18 |
ttcttccattcaaggatgttgcttctgagcttatagcactcccaatggaccgagttaccattctgtcaacttgaaccaacatatagcctctctagaatga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2176806 |
ttcttccattcaaggatgttgcttctgaacttatagcactcccaatggaccgagttaccattctgtcaacttgaaccaacatataacctctctagaatga |
2176707 |
T |
|
| Q |
118 |
aatataagaaaaaatattcaaaaagtcaaatgtatttggttcgagacaccgtagaacacggtatgcagtgttagtgtgtttctgtgtgagtc-ttgggag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| ||||||| |
|
|
| T |
2176706 |
aatataagaaaaaatattcaaaaagtcaaatgtatttggttcgagacaccgtagaacacggtatccagtgttagtgtgtttccttgtgagtctttgggag |
2176607 |
T |
|
| Q |
217 |
ttccaaaagtacttggactacact |
240 |
Q |
| |
|
| |||||||||||||||||||||| |
|
|
| T |
2176606 |
tcccaaaagtacttggactacact |
2176583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 127 - 155
Target Start/End: Original strand, 31846124 - 31846152
Alignment:
| Q |
127 |
aaaaatattcaaaaagtcaaatgtatttg |
155 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31846124 |
aaaaatattcaaaaagtcaaatgtatttg |
31846152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University