View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12142_low_10 (Length: 441)
Name: NF12142_low_10
Description: NF12142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12142_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 2e-93; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 214 - 428
Target Start/End: Complemental strand, 41011812 - 41011602
Alignment:
| Q |
214 |
gttgcggaattatctgcacataaataagactgggtgaaaatatatatgtccacttattttagtgaaccatccattccgctttgtttagggtggattggtg |
313 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41011812 |
gttgcggaattatctgcacataaataagattgggtgaaaatat----gtccacttattttagtggaccatccattccgctttgtttagggtggattggtg |
41011717 |
T |
 |
| Q |
314 |
gcaacgcttcttaattcacttccgatctcttatcttattaagaaatgacatccatgattcaaatacataaattcaaattagatcatgtcccttagtcttt |
413 |
Q |
| |
|
|| ||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41011716 |
gcgacgtttcttaattcacttctgatctcttatcttattaagaaatgacatccatgattcaaatacataaattcaaattagatcatgtcccttagtcttt |
41011617 |
T |
 |
| Q |
414 |
cttggatgcccttct |
428 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
41011616 |
ctcggatgcccttct |
41011602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 114 - 168
Target Start/End: Complemental strand, 41011912 - 41011858
Alignment:
| Q |
114 |
tggaggctttagtggccaaccgtcatttttggcgggcaacccgttaatcggctgc |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41011912 |
tggaggctttagtggccaaccgtcatttttggcgggcaacccgttaatcagctgc |
41011858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 65 - 116
Target Start/End: Complemental strand, 41012025 - 41011974
Alignment:
| Q |
65 |
taactttctctccaaaatggtcaacttgtttaggcatattaaagcgagttgg |
116 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41012025 |
taactttttctccaaaatggtcaacttgtttaggcatattaaagcgagttgg |
41011974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University